99
|
Vazyme Biotech Co
taq pro universal sybr qpcr master mix Taq Pro Universal Sybr Qpcr Master Mix, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/linear+mixed+effect+regression+models+with+a+random+intercept+for+each+subject+proc+mixed/Taq+Pro+Universal+SYBR+qPCR+Master+Mix/pm41350534-375-8-15 Average 99 stars, based on 1 article reviews
taq pro universal sybr qpcr master mix - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
90
|
Oxford Nanopore
flow cell-priming mix exp-flp001 pro.6 Flow Cell Priming Mix Exp Flp001 Pro.6, supplied by Oxford Nanopore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/linear+mixed+effect+regression+models+with+a+random+intercept+for+each+subject+proc+mixed/flow+cell+priming+kit+exp+flp002/10__1080_slash_0886022x__2022__2162419-125-16-21 Average 90 stars, based on 1 article reviews
flow cell-priming mix exp-flp001 pro.6 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
97
|
SAS institute
mixed model approach by sas Mixed Model Approach By Sas, supplied by SAS institute, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/linear+mixed+effect+regression+models+with+a+random+intercept+for+each+subject+proc+mixed/SAS+Model+Risk+Management/pmc01829180-136-10-13 Average 97 stars, based on 1 article reviews
mixed model approach by sas - by Bioz Stars,
2026-09
97/100 stars
|
Buy from Supplier |
90
|
Erich Jaeger GmbH
open circuit spirometry system fitted with a mixing chamber oxycon pro Open Circuit Spirometry System Fitted With A Mixing Chamber Oxycon Pro, supplied by Erich Jaeger GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/linear+mixed+effect+regression+models+with+a+random+intercept+for+each+subject+proc+mixed/spiroergometric+system+oxycon+pro/pm40222028-73-14-18 Average 90 stars, based on 1 article reviews
open circuit spirometry system fitted with a mixing chamber oxycon pro - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Becton Dickinson
biotinylated anti-mouse lineage (lin) markers Biotinylated Anti Mouse Lineage (Lin) Markers, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/linear+mixed+effect+regression+models+with+a+random+intercept+for+each+subject+proc+mixed/anti+cd3/10__1128_slash_iai__00369___17-60-32-80 Average 90 stars, based on 1 article reviews
biotinylated anti-mouse lineage (lin) markers - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
VIASYS HealthCare Inc
jaeger oxycon pro gas machine Jaeger Oxycon Pro Gas Machine, supplied by VIASYS HealthCare Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/linear+mixed+effect+regression+models+with+a+random+intercept+for+each+subject+proc+mixed/jaeger+oxycon+pro/10__70252_slash_wsfl7054-53-11-16 Average 90 stars, based on 1 article reviews
jaeger oxycon pro gas machine - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
96
|
Kyfora Bio
pei Pei, supplied by Kyfora Bio, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/linear+mixed+effect+regression+models+with+a+random+intercept+for+each+subject+proc+mixed/Polyethylenimine%2C+Linear/bio_rxiv__2023__01__08__523166-113-39-40 Average 96 stars, based on 1 article reviews
pei - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
99
|
STATA Corporation
2x2x2 mixed linear model 2x2x2 Mixed Linear Model, supplied by STATA Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/linear+mixed+effect+regression+models+with+a+random+intercept+for+each+subject+proc+mixed/STATA+14%2E0/pm28288443-96-15-28 Average 99 stars, based on 1 article reviews
2x2x2 mixed linear model - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
90
|
Erich Jaeger GmbH
computerized metabolic system with a mixing chamber oxycon pro Computerized Metabolic System With A Mixing Chamber Oxycon Pro, supplied by Erich Jaeger GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/linear+mixed+effect+regression+models+with+a+random+intercept+for+each+subject+proc+mixed/computerized+metabolic+system+with+mixing+chamber+oxycon+pro/pmc11246952-114-16-20 Average 90 stars, based on 1 article reviews
computerized metabolic system with a mixing chamber oxycon pro - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
BUCHI AG
microencapsulation granulator b-395 pro Microencapsulation Granulator B 395 Pro, supplied by BUCHI AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/linear+mixed+effect+regression+models+with+a+random+intercept+for+each+subject+proc+mixed/encapsulator+b+390/pmc09914818-46-13-17 Average 90 stars, based on 1 article reviews
microencapsulation granulator b-395 pro - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
95
|
New England Biolabs
ppw3218  Ppw3218, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/linear+mixed+effect+regression+models+with+a+random+intercept+for+each+subject+proc+mixed/BglI/pmc06794094-466-32-43 Average 95 stars, based on 1 article reviews
ppw3218 - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
90
|
Uniflex Healthcare
standard bucket milking system sac uniflow 4 Standard Bucket Milking System Sac Uniflow 4, supplied by Uniflex Healthcare, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/linear+mixed+effect+regression+models+with+a+random+intercept+for+each+subject+proc+mixed/standard+bucket+milking+system+sac+uniflow+4/pm34024610-59-24-32 Average 90 stars, based on 1 article reviews
standard bucket milking system sac uniflow 4 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: eLife
Article Title: The Mars1 kinase confers photoprotection through signaling in the chloroplast unfolded protein response
doi: 10.7554/eLife.49577
Figure Lengend Snippet: Plasmids Table.
Article Snippet: This 3x-Flag dsDNA, with BglII-compatible sticky ends, was generated upon annealing of the two following single-stranded DNA fragments: 3x-Flag_UP: GATCTGGACTACAAGGACCATGACGGTGACTATAAGGATCACGACATCGACTACAAGGACGATGACGACAAG ; 3x-Flag_DOWN: GATCCTTGTCGTCATCGTCCTTGTAGTCGATGTCGTGATCCTTATAGTCACCGTCATGGTCCTTGTAGTCCA and it was mixed with a linearized and purified
Techniques: Amplification, Sequencing, Clone Assay, Mutagenesis, Subcloning, Generated